DyNA VacS | Integrative Tool for DNA Vaccine Design


Name of Project

Input DNA sequence [Max 3000bps]	atggatctgggaggcttgtccctcgccgcccaccgtagccccggcgctcggccggtcgccgtttccaagatggccgatctgggaggcttgtccctcgccgcccaccgtagccccggcgctcggccggtcgccgtttccaagatggccgatctgggaggcttgtccctcgccgcccaccgtagccccggcgctcggccggtcgccgtttccaagatggccgatctgggaggcttgtccctcgccgcccaccgtagccccggcgctcggccggtcgccgtttccaagatggccgatctgggaggcttgtccctcgccgcccaccgtagccccggcgctcggccggtcgccgtttccaagatggcc Please input sequences in the correct reading frame.Click to know more

Options	Codon Optimisation	Tables Available [Tables based on Highly Expressed Genes are Marked Separately]




Cite this server: Nagarajan Harish, Rekha Gupta, Parul Agarwal, Vinod Scaria and Beena Pillai DyNAVacS:An Integrative Tool for Optimised DNA Vaccine Design Nucleic Acids Research (in Press)
Website copyright © Institute of Genomics and Integrative Biology. All Rights Reserved. The servers are free for academic use. Please contact IPR Cell for commercial use.No part of this should be Downloaded or used in any way without prior permission of the Director, IGIB. Best viewed at 800 X 600 Resolutions \| Internet Explorer 5.0 - Later Version \| Please contact Dr Vinod Scaria or Dr.Beena Pillai regarding server accessibility.

dynavacs workflow

Click on image map above to use modules independently